Top » Catalog » J1 » FGC22258

$18.00

FGC22258
[FGC22258]

FGC22258
hg38 Position: ChrY:16590336..16590336
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22258_F AGGATTTGGATCTCTGATTGTCTC
Reverse Primer: FGC22258_R CCCATTTCTTGTTTTGGTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC19502
$18.00
Haplogroup Info
Other products
Currencies