Top » Catalog » J1 » FGC22259

$18.00

FGC22259
[FGC22259]

FGC22259
hg38 Position: ChrY:17052281..17052281
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22259_F AGTGTCAGCCTCCACATCC
Reverse Primer: FGC22259_R AGACTTTCCCTGAGGCTGTTC
Reviews

Customers who bought this product also purchased
Z18219
Z18219
FGC4486
FGC4486
FGC11
FGC11
DNA Sample Kit
DNA Sample Kit
ZS5205
ZS5205
BY145
BY145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies