Top » Catalog » J1 » FGC22262

$18.00

FGC22262
[FGC22262]

FGC22262
hg38 Position: ChrY:12265822..12265822
Ancestral: del
Derived: ins
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22262v2_F CTGAAGCTCCCCATACCCTAC
Reverse Primer: FGC22262v2_R TGGAACCAGCTTCCACTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK8
1 x BY70856
1 x FGC50950
1 x FGC48131
1 x A14648
1 x ALK7
1 x FGC4244
1 x FGC43122
1 x A22250
1 x FGC7392
1 x FGC8715
1 x BY171997
1 x A22240
1 x A23665
1 x A18552
1 x FGC47230
1 x FGC7381
1 x FGC6778
1 x FGC5234
1 x A21957
1 x ALK404
1 x FGC10409
1 x BY188935
1 x A13645
1 x FGC4440
1 x FGC4433
1 x A21955
1 x ALK171
$504.00
Haplogroup Info
Other products
Currencies