Top » Catalog » J1 » FGC23317

$18.00

FGC23317
[FGC23317]

FGC23317
hg38 Position: ChrY:13193002..13193002
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: Below FGC5427 > Z18219
Forward Primer: FGC23317v21_F ACGGGCTGTTGAATTCAATC
Reverse Primer: FGC23317v21_R GGACATTGCAATTGATGTTACAG
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Y22049
Y22049
Z18220
Z18220
FGC5424
FGC5424
Z18219
Z18219
BY37871
BY37871
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies