Top » Catalog » J1 » FGC23317

$18.00

FGC23317
[FGC23317]

FGC23317
hg38 Position: ChrY:13193002..13193002
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: Below FGC5427 > Z18219
Forward Primer: FGC23317v21_F ACGGGCTGTTGAATTCAATC
Reverse Primer: FGC23317v21_R GGACATTGCAATTGATGTTACAG
Reviews

Customers who bought this product also purchased
BY37871
BY37871
ZS10289
ZS10289
ZS6416
ZS6416
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies