Top » Catalog » J1 » FGC32851

$18.00

FGC32851
[FGC32851]

FGC32851
hg38 Position: ChrY:17402739..17402740
Ancestral: del
Derived: ins
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC32851_F TTATCCAGGGCTTGAAGCAG
Reverse Primer: FGC32851_R TTGTATGCTGCTCCAGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies