Top » Catalog » J1 » FGC35893

$18.00

FGC35893
[FGC35893]

FGC35893
hg38 Position: ChrY:8539710..8539710
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC35893_F GGCGTCCCAACAACAGTAAG
Reverse Primer: FGC35893_R AGGTGGCAGATTTCAGGTTG
Reviews

Customers who bought this product also purchased
ZS7395
ZS7395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC39467
$18.00
Haplogroup Info
Other products
Currencies