Top » Catalog » J1 » FGC15762

$18.00

FGC15762
[FGC15762]

FGC15762
hg38 Position: ChrY:19965974..19965974
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Equiv. to FGC15755. Below L858 > Z640 > FGC5230 > FGC5206
Forward Primer: FGC15762_F TCTTTTGCTGTATGGAAGCTTTC
Reverse Primer: FGC15762_R GAATTCCAACTACAGTACAAGGCTG
Reviews

Customers who bought this product also purchased
FGC60704
FGC60704
Z640
Z640
FGC59067
FGC59067
FGC15760
FGC15760
FGC60653
FGC60653
FGC7984
FGC7984
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y25695
$18.00
Haplogroup Info
Other products
Currencies