Top » Catalog » J1 » FGC15762

$18.00

FGC15762
[FGC15762]

FGC15762
hg38 Position: ChrY:19965974..19965974
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Equiv. to FGC15755. Below L858 > Z640 > FGC5230 > FGC5206
Forward Primer: FGC15762_F TCTTTTGCTGTATGGAAGCTTTC
Reverse Primer: FGC15762_R GAATTCCAACTACAGTACAAGGCTG
Reviews

Customers who bought this product also purchased
FGC5235
FGC5235
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5206
FGC5206
FGC60704
FGC60704
Z640
Z640
FGC59067
FGC59067
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS1392
$18.00
Haplogroup Info
Other products
Currencies