Top » Catalog » J1 » FGC5229

$18.00

FGC5229
[FGC5229]

FGC5229
hg38 Position: ChrY:12825792..12825792
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858 > Z640 > FGC5230 > FGC5206
Forward Primer: FGC5229_F AGCCAACTGAAAAGCTCTCG
Reverse Primer: FGC5229_R ACGCCTATAATCCCAGCTACC
Reviews

Customers who bought this product also purchased
BY74
BY74
FGC5230
FGC5230
FGC11
FGC11
FGC1695
FGC1695
Z2293
Z2293
L858
L858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10028
1 x ALK562
1 x FGC20885
1 x FGC22249
1 x A17832
$90.00
Haplogroup Info
Other products
Currencies