Top » Catalog » J1 » CTS7188

$18.00

CTS7188
[CTS7188]

CTS7188
hg38 Position: ChrY:15228838..15228838
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1
Comments: Below Z1828 > CTS1460
Forward Primer: CTS7188_F CAGGAGGAATTTAGCTGAGCAC
Reverse Primer: CTS7188_R GGATTCAGGACAGAGGTTGG
Reviews

Customers who bought this product also purchased
Y5345
Y5345
ZS2958
ZS2958
ZS3006
ZS3006
ZS3042
ZS3042
Y166748
Y166748
ZS241
ZS241
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC1731
1 x FGC8703
1 x FGC41248
1 x FGC40491
1 x A15545
1 x FGC9589
$108.00
Haplogroup Info
Other products
Currencies