Top » Catalog » J1 » FGC41680

$18.00

FGC41680
[FGC41680]

FGC41680
hg38 Position: ChrY:7065118..7065118
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC41680_F TTGTCTGCTTTGGGTCAATG
Reverse Primer: FGC41680_R AAACAGCTTGTGCAGAGGAAC
Reviews

Customers who bought this product also purchased
FGC11
FGC11
FGC1695
FGC1695
Z2293
Z2293
BY74
BY74
FGC23369
FGC23369
FGC5235
FGC5235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5216
1 x A22236
1 x FGC35899
1 x FGC5475
1 x FGC4286
1 x FGC4
1 x ALK205
1 x FGC8710
1 x BY37872
1 x A13647
1 x FGC4357
1 x FGC19205
1 x FGC4348
1 x FGC8733
1 x A24906
1 x A23662
1 x A13640
1 x BY136
1 x A16981
$342.00
Haplogroup Info
Other products
Currencies