Top » Catalog » J1 » BY82

$18.00

BY82
[BY82]

BY82
hg38 Position: ChrY:3020037..3020037
Ancestral: C
Derived: G
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY82_F GATATGTGGGGGTGGCTATG
Reverse Primer: BY82_R AATCTGCCTTCCAACAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK899
$18.00
Haplogroup Info
Other products
Currencies