Top » Catalog » J1 » B238

$18.00

B238
[B238]

B238
hg38 Position: ChrY:13544856..13544856
Ancestral: A
Derived: C
Reference: Karmin et al. (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: B238_F ATGTCTCCAGGCACAACTCC
Reverse Primer: B238_R GGTGATTTTTGACCTCTCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19272
1 x A23660
1 x FGC9583
1 x ALK354
1 x FGC22555
1 x FGC50884
1 x FGC1715
1 x FGC5426
1 x ALK426
1 x A13633
1 x ALK2
1 x FGC4385
$216.00
Haplogroup Info
Other products
Currencies