Top » Catalog » J1 » CTS11741

$18.00

CTS11741
[CTS11741]

CTS11741
hg38 Position: ChrY:21084179..21084179
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1a1b1b1a2a1a1a
Comments: Syn. with CTS11741; downstream PF4843
Forward Primer: CTS11741_F TGCACACAAAAGAAATGTGATG
Reverse Primer: CTS11741_R TGCAGGCTGAAGAGAGAGTG
Reviews

Customers who bought this product also purchased
ZS5944
ZS5944
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Z2324
Z2324
ZS6165
ZS6165
ZS241
ZS241
FGC4737
FGC4737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies