Top » Catalog » J1 » CTS11741

$18.00

CTS11741
[CTS11741]

CTS11741
hg38 Position: ChrY:21084179..21084179
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1a1b1b1a2a1a1a
Comments: Syn. with CTS11741; downstream PF4843
Forward Primer: CTS11741_F TGCACACAAAAGAAATGTGATG
Reverse Primer: CTS11741_R TGCAGGCTGAAGAGAGAGTG
Reviews

Customers who bought this product also purchased
ZS241
ZS241
FGC4737
FGC4737
L862
L862
FGC4745
FGC4745
PF4845
PF4845
P58
P58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies