Top » Catalog » J1 » FGC23930

$18.00

FGC23930
[FGC23930]

FGC23930
hg38 Position: ChrY:19039396..19039396
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC23930_F CTGGGAAAAGTGGACCCAG
Reverse Primer: FGC23930_R CAGTGTAGTCCCCATGTCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY93
1 x FGC4754
$36.00
Haplogroup Info
Other products
Currencies