Top » Catalog » J1 » BY75

$18.00

BY75
[BY75]

BY75
hg38 Position: ChrY:2878979..2878979
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Downstream ZS2374
Forward Primer: BY75_F CCAGGCTTTTTCCTTGTACG
Reverse Primer: BY75_R AAGCTGAAGTTGGGATGGTG
Reviews

Customers who bought this product also purchased
ZS2373
ZS2373
V1662
V1662
ZS2374
ZS2374
ZS10316
ZS10316
J1-ZS2374 Panel
J1-ZS2374 Panel
S15852
S15852
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies