Top » Catalog » J1 » BY107

$18.00

BY107
[BY107]

BY107
hg38 Position: ChrY:8000732..8000732
Ancestral: C
Derived: T
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY107_F TTACCATCTCGAGGAGTAAAATG
Reverse Primer: BY107_R ACTCCCTTCTTGCCCAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies