Top » Catalog » J1 » FGC4423

$18.00

FGC4423
[FGC4423]

FGC4423
hg38 Position: ChrY:14816366..14816366
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC12 > FGC4415 > FGC4411
Forward Primer: FGC4423_F TGAGTGTTCTCAATACACATATGGAG
Reverse Primer: FGC4423_R ACCCAGTTAGCAGAACTACTGGTG
Reviews

Customers who bought this product also purchased
FGC4411
FGC4411
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4415
FGC4415
ZS10297
ZS10297
FGC1695
FGC1695
FGC4708
FGC4708
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12920
1 x A13636
$36.00
Haplogroup Info
Other products
Currencies