Top » Catalog » J1 » FGC4423

$18.00

FGC4423
[FGC4423]

FGC4423
hg38 Position: ChrY:14816366..14816366
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC12 > FGC4415 > FGC4411
Forward Primer: FGC4423_F TGAGTGTTCTCAATACACATATGGAG
Reverse Primer: FGC4423_R ACCCAGTTAGCAGAACTACTGGTG
Reviews

Customers who bought this product also purchased
FGC4402
FGC4402
FGC5
FGC5
BY4
BY4
ZS8853
ZS8853
FGC11
FGC11
BY8
BY8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies