Top » Catalog » J1 » FGC4430

$18.00

FGC4430
[FGC4430]

FGC4430
hg38 Position: ChrY:18884240..18884240
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4430_F GGTACATTTTTGGAAAAGACATTAATTAG
Reverse Primer: FGC4430_R AGTAGGAGAAAAGAAAGAAATCAGAGC
Reviews

Customers who bought this product also purchased
ZS8303
ZS8303
ZS9296
ZS9296
ZS10545
ZS10545
FGC4417
FGC4417
ZS12344
ZS12344
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC41745
1 x FGC4429
1 x FGC37526
1 x FGC29983
1 x BY81893
1 x FGC16658
1 x A17827
1 x A19271
1 x FGC5237
1 x FGC5488
1 x FGC42835
1 x FGC20860
1 x FGC4712
1 x A14885
1 x FGC12832
1 x FGC48132
1 x BY40741
1 x FGC5424
1 x BY68843
$342.00
Haplogroup Info
Other products
Currencies