Top » Catalog » J1 » CTS3041

$18.00

CTS3041
[CTS3041]

CTS3041
hg38 Position: ChrY:12515151..12515151
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3041_F CATTCAACTCAAGAAGTCATGCC
Reverse Primer: CTS3041_R GCTGGGATTACGGGCATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6526
1 x Y11972
1 x Y79240
1 x A19270
1 x BY3
$90.00
Haplogroup Info
Other products
Currencies