Top » Catalog » J1 » CTS3041

$18.00

CTS3041
[CTS3041]

CTS3041
hg38 Position: ChrY:12515151..12515151
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3041_F CATTCAACTCAAGAAGTCATGCC
Reverse Primer: CTS3041_R GCTGGGATTACGGGCATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK392
1 x FGC4451
1 x FGC4292
1 x FGC39179
1 x FGC22747
1 x FGC34247
1 x F4320
1 x CTS9501
1 x FGC40451
1 x FGC42458
1 x BY148572
1 x FGC48150
1 x FGC8224
1 x FGC49889
1 x FGC22259
1 x FGC39175
1 x FGC17483
1 x CTS8308
1 x ALK136
$342.00
Haplogroup Info
Other products
Currencies