Top » Catalog » J1 » BY136

$18.00

BY136
[BY136]

BY136
hg38 Position: ChrY:20929150..20929150
Ancestral: A
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1
Comments: Aka FGC19909
Forward Primer: BY136_F GAGGCTCTGAAAGCAGAAGAG
Reverse Primer: BY136_R TCCTGGCCTGTCAACAAATC
Reviews

Customers who bought this product also purchased
Y184791
Y184791
ZS11392
ZS11392
ZS11116
ZS11116
ZS4082
ZS4082
BY6
BY6
ZS2007
ZS2007
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies