Top » Catalog » J1 » FGC31327

$18.00

FGC31327
[FGC31327]

FGC31327
hg38 Position: ChrY:16117809..16117809
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC1695 > BY8 > BY9
Forward Primer: FGC31327_F CGGTCTATCAATTTTGTCGATCT
Reverse Primer: FGC31327_R AGGGTTAAGAATCTCACTCAAAAACT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC11723
1 x FGC34536
1 x FGC39173
$54.00
Haplogroup Info
Other products
Currencies