Top » Catalog » J1 » FGC39467

$18.00

FGC39467
[FGC39467]

FGC39467
hg38 Position: ChrY:20419132..20419132
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC39468
Forward Primer: FGC39467_F TTGACCTGTTTGTCATGATTCAG
Reverse Primer: FGC39467_R TCTTATGGCAAGGTCAAATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies