Top » Catalog » J1 » BY6

$18.00

BY6
[BY6]

BY6
hg38 Position: ChrY:15077416..15077416
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY6_F CATAATTTCATGGGCTGTTCTAGC
Reverse Primer: BY6_R CATCCATGGCCATTCACTC
Reviews

Customers who bought this product also purchased
ZS4082
ZS4082
ZS10813
ZS10813
ZS11598
ZS11598
BY11342
BY11342
ZS11604
ZS11604
ZS10814
ZS10814
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23319
1 x FGC22261
1 x BY11342
1 x A21959
1 x FGC50885
1 x A19161
1 x BY9
1 x FGC4453
1 x FGC14710
1 x FGC9581
1 x FGC4459
1 x FGC40444
1 x FGC50880
$234.00
Haplogroup Info
Other products
Currencies