Top » Catalog » J1 » BY6

$18.00

BY6
[BY6]

BY6
hg38 Position: ChrY:15077416..15077416
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY6_F CATAATTTCATGGGCTGTTCTAGC
Reverse Primer: BY6_R CATCCATGGCCATTCACTC
Reviews

Customers who bought this product also purchased
Y184791
Y184791
ZS1951
ZS1951
BY136
BY136
Y60807
Y60807
FGC1714
FGC1714
ZS11112
ZS11112
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies