Top » Catalog » J1 » BY9

$18.00

BY9
[BY9]

BY9
hg38 Position: ChrY:14067457..14067457
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Aka FGC14303
Forward Primer: BY9_F GTGCTGGTGGAGGCTATGG
Reverse Primer: BY9_R TTGAGTTGACAGTGGTGACAGC
Reviews

Customers who bought this product also purchased
Y28816
Y28816
YP5578
YP5578
YP5904
YP5904
Y879
Y879
Y2568
Y2568
BY250
BY250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies