Top » Catalog » J1 » FGC10601

$18.00

FGC10601
[FGC10601]

FGC10601
hg38 Position: ChrY:14332927..14332927
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC10601_F TTTAAGAGTAGAATGCACCGTCTC
Reverse Primer: FGC10601_R CACTTTAGCTTTGGCATTGGTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies