Top » Catalog » J1 » FGC40454

$18.00

FGC40454
[FGC40454]

FGC40454
hg38 Position: ChrY:19166493..19166493
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC40454_F TGGTGAGAACCCATTTCCAC
Reverse Primer: FGC40454_R AGGATGGTCTCAACCTGCTG
Reviews

Customers who bought this product also purchased
ZS3862
ZS3862
FGC8806
FGC8806
FGC5
FGC5
SK1154
SK1154
FGC1721
FGC1721
FGC40451
FGC40451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19929
$18.00
Haplogroup Info
Other products
Currencies