Top » Catalog » J1 » FGC40454

$18.00

FGC40454
[FGC40454]

FGC40454
hg38 Position: ChrY:19166493..19166493
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC40454_F TGGTGAGAACCCATTTCCAC
Reverse Primer: FGC40454_R AGGATGGTCTCAACCTGCTG
Reviews

Customers who bought this product also purchased
FGC5
FGC5
SK1154
SK1154
FGC1721
FGC1721
FGC40451
FGC40451
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS3856
ZS3856
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies