Top » Catalog » J1 » FGC4440

$18.00

FGC4440
[FGC4440]

FGC4440
hg38 Position: ChrY:2801950..2801950
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4440_F TCAAATAACAGTCATAAAAACATTGTCAG
Reverse Primer: FGC4440_R CAGTATTCACAAGGGCAAAGAGAC
Reviews

Customers who bought this product also purchased
ZS10499
ZS10499
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC7
FGC7
FGC4455
FGC4455
FGC1713
FGC1713
ZS4995
ZS4995
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies