Top » Catalog » J1 » FGC4451

$18.00

FGC4451
[FGC4451]

FGC4451
hg38 Position: ChrY:9310745..9310745
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC4453
Forward Primer: FGC4451_F GCTACAGGTGAATGAAAACACAAC
Reverse Primer: FGC4451_R AAAAATTGAAATGTTATTTCTGCTGC
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
ZS10466
ZS10466
FGC10591
FGC10591
ZS4691
ZS4691
FGC5
FGC5
FGC10576
FGC10576
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38648
1 x A20304
1 x FGC4720
1 x A13635
1 x FGC13864
1 x FGC4358
1 x FGC14446
1 x FGC4356
$144.00
Haplogroup Info
Other products
Currencies