Top » Catalog » J1 » FGC4451

$18.00

FGC4451
[FGC4451]

FGC4451
hg38 Position: ChrY:9310745..9310745
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC4453
Forward Primer: FGC4451_F GCTACAGGTGAATGAAAACACAAC
Reverse Primer: FGC4451_R AAAAATTGAAATGTTATTTCTGCTGC
Reviews

Customers who bought this product also purchased
FGC5
FGC5
FGC10576
FGC10576
FGC8806
FGC8806
L1303
L1303
FGC1707
FGC1707
ZS8181
ZS8181
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies