Top » Catalog » J1 » FGC4451

$18.00

FGC4451
[FGC4451]

FGC4451
hg38 Position: ChrY:9310745..9310745
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC4453
Forward Primer: FGC4451_F GCTACAGGTGAATGAAAACACAAC
Reverse Primer: FGC4451_R AAAAATTGAAATGTTATTTCTGCTGC
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
ZS8181
ZS8181
FGC4453
FGC4453
ZS9061
ZS9061
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS11309
ZS11309
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies