Top » Catalog » J1 » FGC4465

$18.00

FGC4465
[FGC4465]

FGC4465
hg38 Position: ChrY:21312371..21312371
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4465_F GAAGATATCAAAATTTCTTAATTTTGTTTACTTC
Reverse Primer: FGC4465_R CGATGTGCAAATCATGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY144072
1 x FGC29980
1 x FGC4737
$54.00
Haplogroup Info
Other products
Currencies