Top » Catalog » J1 » FGC4465

$18.00

FGC4465
[FGC4465]

FGC4465
hg38 Position: ChrY:21312371..21312371
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4465_F GAAGATATCAAAATTTCTTAATTTTGTTTACTTC
Reverse Primer: FGC4465_R CGATGTGCAAATCATGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47437
1 x CTS11741
1 x FGC5205
1 x FGC42828
1 x A18933
1 x ALK396
1 x BY74
1 x CTS15
1 x FGC17478
1 x ALK199
1 x A18075
1 x A22248
1 x FGC39467
1 x B238
1 x ALK395
1 x FGC30416
$288.00
Haplogroup Info
Other products
Currencies