Top » Catalog » J1 » FGC4459

$18.00

FGC4459
[FGC4459]

FGC4459
hg38 Position: ChrY:18902543..18902543
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4459_F ATAGCGCCGTTGTACTCCAG
Reverse Primer: FGC4459_R TCTTGGCCTTTCCTGTTCAC
Reviews

Customers who bought this product also purchased
ZS4995
ZS4995
FGC2
FGC2
FGC4441
FGC4441
FGC4452
FGC4452
FGC5
FGC5
FGC4440
FGC4440
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies