Top » Catalog » J1 » FGC4459

$18.00

FGC4459
[FGC4459]

FGC4459
hg38 Position: ChrY:18902543..18902543
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4459_F ATAGCGCCGTTGTACTCCAG
Reverse Primer: FGC4459_R TCTTGGCCTTTCCTGTTCAC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC7
FGC7
FGC4455
FGC4455
FGC1713
FGC1713
ZS4995
ZS4995
FGC2
FGC2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies