Top » Catalog » J1 » FGC4455

$18.00

FGC4455
[FGC4455]

FGC4455
hg38 Position: ChrY:14785146..14785146
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4455_F GAGCATAATAGACATTGTGACCTATAACAG
Reverse Primer: FGC4455_R GAGATTCAAATAAGTACTTGGAGCTTCTAC
Reviews

Customers who bought this product also purchased
FGC4453
FGC4453
ZS10499
ZS10499
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC7
FGC7
ZS4995
ZS4995
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4451
$18.00
Haplogroup Info
Other products
Currencies