Top » Catalog » J1 » BY3

$18.00

BY3
[BY3]

BY3
hg38 Position: ChrY:17248774..17248774
Ancestral: G
Derived: T
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Aka FGC15184
Forward Primer: BY3_F ATGGGTTTCCCTCCTGAATAAC
Reverse Primer: BY3_R GAAAGGAATTAGAATCTTACTTGGACTATAG
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
BY2
BY2
FGC15177
FGC15177
FGC5
FGC5
FGC8806
FGC8806
Z18225
Z18225
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4285
1 x FGC42837
1 x FGC4421
1 x A23687
1 x A16979
1 x BY200880
1 x FGC30570
1 x ALK367
1 x BY38105
1 x FGC39468
1 x FGC1703
1 x FGC30701
1 x FGC5224
1 x BY152331
1 x FGC10424
1 x A23886
1 x FGC3722
1 x FGC4480
1 x ALK174
1 x FGC4355
1 x FGC19504
$378.00
Haplogroup Info
Other products
Currencies