Top » Catalog » J1 » BY3

$18.00

BY3
[BY3]

BY3
hg38 Position: ChrY:17248774..17248774
Ancestral: G
Derived: T
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Aka FGC15184
Forward Primer: BY3_F ATGGGTTTCCCTCCTGAATAAC
Reverse Primer: BY3_R GAAAGGAATTAGAATCTTACTTGGACTATAG
Reviews

Customers who bought this product also purchased
ZS9061
ZS9061
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC7944
FGC7944
FGC10591
FGC10591
FGC7
FGC7
L1303
L1303
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies