Top » Catalog » J1 » FGC15173

$18.00

FGC15173
[FGC15173]

FGC15173
hg38 Position: ChrY:6891358..6891358
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15173_F TTGAATGCTTGCATCCTGC
Reverse Primer: FGC15173_R CACCTTATGGAAGAGAAAGTCAAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC41745
1 x FGC4429
1 x FGC37526
1 x FGC29983
1 x BY81893
1 x FGC16658
1 x A17827
1 x A19271
1 x FGC5237
1 x FGC5488
1 x FGC42835
1 x FGC20860
1 x FGC4712
$234.00
Haplogroup Info
Other products
Currencies