Top » Catalog » J1 » FGC15177

$18.00

FGC15177
[FGC15177]

FGC15177
hg38 Position: ChrY:8340997..8340997
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15177_F AACGGTGTCACTCTCAAATCC
Reverse Primer: FGC15177_R TTGGCAGCGTCTAGAATAGG
Reviews

Customers who bought this product also purchased
BY3
BY3
FGC5
FGC5
FGC8806
FGC8806
Z18225
Z18225
FGC1707
FGC1707
FGC4453
FGC4453
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies