Top » Catalog » J1 » FGC15177

$18.00

FGC15177
[FGC15177]

FGC15177
hg38 Position: ChrY:8340997..8340997
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15177_F AACGGTGTCACTCTCAAATCC
Reverse Primer: FGC15177_R TTGGCAGCGTCTAGAATAGG
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC7944
FGC7944
FGC10591
FGC10591
FGC7
FGC7
L1303
L1303
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19278
1 x B233
1 x A13640
$54.00
Haplogroup Info
Other products
Currencies