Top » Catalog » J1 » FGC15213

$18.00

FGC15213
[FGC15213]

FGC15213
hg38 Position: ChrY:21243402..21243402
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15213_F GTCTGGGTCTTCCTGACTGG
Reverse Primer: FGC15213_R TGCCCCACTACCAAACAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY38119
1 x ALK6
1 x A20820
$54.00
Haplogroup Info
Other products
Currencies