Top » Catalog » J1 » FGC16639

$18.00

FGC16639
[FGC16639]

FGC16639
hg38 Position: ChrY:21171717..21171717
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC16639_F CGCATCACTTTCAGGTACACCAATG
Reverse Primer: FGC16639_R ACCATCATCAAAGACCAAAAGTAGTTAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y147567
1 x Z4440
1 x FGC10608
1 x Z14308
$72.00
Haplogroup Info
Other products
Currencies