Top » Catalog » J1 » FGC16639

$18.00

FGC16639
[FGC16639]

FGC16639
hg38 Position: ChrY:21171717..21171717
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC16639_F CGCATCACTTTCAGGTACACCAATG
Reverse Primer: FGC16639_R ACCATCATCAAAGACCAAAAGTAGTTAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23924
1 x A19264
1 x B234
1 x FGC11755
1 x FGC5425
1 x FGC10030
1 x FGC8196
1 x BY259
1 x FGC23318
1 x ALK559
1 x A24503
1 x BY13766
1 x ALK723
1 x FGC5419
1 x FGC22737
$270.00
Haplogroup Info
Other products
Currencies