Top » Catalog » J1 » FGC29847

$18.00

FGC29847
[FGC29847]

FGC29847
hg38 Position: ChrY:20023422..20023422
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: Aka BY241
Forward Primer: FGC29847_F GACATGGTATAAGGAAGGAATGC
Reverse Primer: FGC29847_R GTCACCCAGGCTGAAGTGC
Reviews

Customers who bought this product also purchased
FGC4371
FGC4371
FGC5486
FGC5486
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC31627
FGC31627
FGC1696
FGC1696
FGC4358
FGC4358
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC1731
1 x FGC8703
1 x FGC41248
1 x FGC40491
1 x A15545
1 x FGC9589
$108.00
Haplogroup Info
Other products
Currencies