Top » Catalog » J1 » FGC29847

$18.00

FGC29847
[FGC29847]

FGC29847
hg38 Position: ChrY:20023422..20023422
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: Aka BY241
Forward Primer: FGC29847_F GACATGGTATAAGGAAGGAATGC
Reverse Primer: FGC29847_R GTCACCCAGGCTGAAGTGC
Reviews

Customers who bought this product also purchased
FGC4358
FGC4358
FGC34247
FGC34247
FGC5
FGC5
BY2
BY2
FGC31133
FGC31133
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC37840
$18.00
Haplogroup Info
Other products
Currencies