Top » Catalog » J1 » FGC29870

$18.00

FGC29870
[FGC29870]

FGC29870
hg38 Position: ChrY:20776166..20776166
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC29870_F TTTTCTTGGCTTTGCACTGG
Reverse Primer: FGC29870_R AGCATATTCCCACCCACATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY144072
1 x FGC29980
$36.00
Haplogroup Info
Other products
Currencies