Top » Catalog » J1 » FGC29870

$18.00

FGC29870
[FGC29870]

FGC29870
hg38 Position: ChrY:20776166..20776166
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC29870_F TTTTCTTGGCTTTGCACTGG
Reverse Primer: FGC29870_R AGCATATTCCCACCCACATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19335
1 x ALK279
1 x FGC4739
1 x FGC31322
1 x BY14469
1 x ALK213
1 x FGC29873
1 x FGC5441
1 x FGC5434
1 x FGC1721
1 x FGC10413
1 x FGC4416
1 x FGC4486
$234.00
Haplogroup Info
Other products
Currencies